What is Annealing Temperature in PCR? How to Calculate and Set It? 

The annealing temperature is the temperature at which the PCR primers bind to the complementary template region, usually is between 50ºC to 68ºC. 


We have started exploring PCR, PCR optimization and related things, once again. We already have many articles on a present topic which you can read on our blog. I have mastery in PCR and related techniques, and that’s why I am daring to write things around it. 

Our motto is to give you the best advice which you can use to optimize your experiments, notwithstanding, the protocol and procedure may vary from lab to lab. 

Ok, so let’s come to the point.  

Researchers use PCR the amplify/synthesize the DNA, its thermocycler which relies on the temperature differences. Meaning, Using different temperature we can achieve amplification. 

If you are reading this article, I can imagine probably you know some basics stuff regarding PCR. So we ain’t discuss it here, tons of content our blog has!

In the present blog post, I will only explain to you what the annealing temperature is! And how can you set one? In addition, I will also make you understand how you can optimize your PCR by annealing temperature. 

Stay tuned,

What is PCR annealing temperature? 

Put simply, the annealing temperature is a temperature at which the primers bind to the complementary region on the target DNA. How the “set annealing temperature” will behave during the reaction depends on the primer length and composition. 

So first we have to understand how primers are designed. You can read this article to learn more: PCR primer design Guidelines.  

A good pair of PCR primers must follow several criteria, here are some, 

  • Length between 18 to 22. 
  • GC content between 50 to 55%. 
  • Low hairpin structure 
  • Low primer-dimer tendency. 
  • High specificity. 

The annealing temperature depends on the length of the primers, GC content and specificity. And of course on the melting temperature!

“At a temperature, half of the template unwind is our melting temperature, so technically at that temperature, our primer can’t bind to the target. We have to set the temperature below it.” 

The annealing temperature is a temperature below the melting temperature which facilities primer binding. Now you may wonder what exactly happens during annealing? 

As we said, it’s a step in amplification that do primer-template binding at the complementary location, meaning, if the annealing temperature is calculated accurately, it will only bind to its target location. 

During the step, hydrogen bonds form between the nucleotides of the opposite strands. Once assure binding, Taq DNA polymerase start synthesizing the strand by using the 3’ OH end of primers. 

Ideally, the annealing temperature (Ta) should be 5ºC lower than the melting temperature (Tm), although check out the annealing temperature of the primer design software too. 

It is very important to know that the GC content of the primer also influences the annealing temperature too. Higher the GC content, the higher the annealing temperature. 

“The GC content is directly proportional to the annealing temperature of the primers.” 

In order to understand this step more accurately, we have to understand what happens during higher and lower annealing temperatures. 

Too high annealing temperature: 

There is a specific temperature at which primers bind, however, when the temperature exceeds primers can’t bind with their template. We will get fewer amplicons. In most cases, a higher annealing temperature leads to ‘no amplification’.

Sometimes truncated amplicons, immature or incomplete amplicons products obtain. In short, results of too high annealing are either non-conclusive or no-amplification. 

Too low annealing temperature: 

When it comes to lower annealing, the performer has to face many problems. It would be non-specific amplification or primer dimer. 

When we set PCR at a lower annealing temperature it gives relaxation to primers. Sometimes, it’s like a free ticket for primers to bind at any position in the genome. It anneals at any place and gives an amplification band or many bands.  

So first, at lower annealing, we may get many various DNA bands/ amplicons that are undesirable. In another scenario, it binds to a similar type of sequence which has almost the same size and gives a DNA band. 

That DNA band or amplicon is still non-complimentary and hard to interpret.  

Primer-dimer is yet another in which primers bind to each other and synthesize smaller PCR amplicons. Those are fragments observed between 50 to 100bp regions, however, are dimers. 

In short, too low an annealing temperature can cause way more problems than too high. Therefore, correct annealing has a key significance in PCR. 

How to calculate annealing temperature? 

For calculating the exact annealing, we need to first calculate the melting temperature of primers. The equation for it is: 

Melting temperature= 4(G + C) + 2(A + T) ºC.

For example, we have a primer, GTACATCGGCGTTTATACATAG having 22 bases. 

It has 9 G/C and 13 A/T so, 

=4(G + C) + 2(A + T) ºC

=4(5 + 4) + 2(6 + 7)

=4(9) + 2(13)

=36 + 26

=62ºC

So the melting temperature of this primer may be nearly 62ºC and so the annealing temperature of it might be ~57ºC or 60ºC. We have to calculate the same for another primer and tentatively find the average. 

In summary, we have to put 3 to 4 temperature variations in the PCR to check the best one. Meaning, we can’t rely on a single temperature. 

That’s a manual process, nowadays much online software available can find a primer set as well as calculate annealing temperature for us. 

Annealing time: 

Besides, setting the temperature for primer binding, the time duration for the step is indeed important. The ideal time for the step is 30 to 60 sec. 

Change in time may influence results negatively. For instance, even though we have a good annealing point but performed the step for 2 minutes, it might produce non-specific bands and primer-dimer too. 

Optimizing Annealing temperature: 

Now coming to the interesting part of this post, how we can optimize the annealing step for multiplex PCR? Meaning for more than one template? 

That’s hard right! Because every template has a different one and that might not be covered in the PCR gradient. So what can we do? We can manipulate the reaction using reagents such as DMSO or MgCl2. 

Using an appropriate amount of DMSO in the PCR reaction can decrease or adjust the annealing temperature. For let say, you have two reactions with 65ºC and 60ºC and you have a simple PCR machine (no temperature gradients). 

Adding a pinch of DMSO in the 65ºC reaction will adjust it and can make it amplify at 60ºC. 

Likewise, adding a pinch of MgCl2 increases the amplification capacity even at the higher annealing temperature. However, you need to first optimize how much amount is required.  

Wrapping up: 

PCR annealing temperature isn’t the only factor that influences final results. Many things such as primer designing, ingredient concentration, reaction buffer, reagents used and template quality & quantity have a definite role. So achieving a successful amplification isn’t that much easy. One needs to have the experience to do this. 

Playing with a PCR is fun! you know you can get many things from a single conventional PCR setup and can generate huge optimization data. If you like genetics, perhaps you have to learn PCR, even though you have to pay for it. Go our in real labs, do internship or training and learn PCR basics.

That’s all for today’s topic, feel free to ask anything.

FAQs:

How to set annealing Temperature in PCR? 

I have already explained everything, Now I will explain this portion in steps, 

First, go to Primer 3 (this URL https://primer3.ut.ee/ ) and design primers, you can get your annealing temperature there. We already have given the link for how you can design PCR primers, somewhere in the article. 

Now you can check manually the annealing temperature using the equation given below.

Go to the screen of your thermocycler 

  1. > click on edit temperature
  2. >> click on the annealing step (the middle) (shown by red error)
  3. >>> click on edit temperature
  4. >>>> insert the temperature value you get from the primer 3.
  5. >>>>> save protocol 
Figure showing how to setup PCR annealing temperature. (A) showing the annealing step and (B) showing the gradient temperature setup.
Figure showing how to set up PCR annealing temperature. (A) showing the annealing step and (B) showing the gradient temperature setup.

That’s how you can set annealing temperature in PCR.

Why the need for 35 45 amplification cycles in rt-pcr tests for COVID 19?

By running 35 to 45 cycles we can get accurate Ct value in the rt-PCR for the COVID 19, this article will help you to learn more: What is the Ct value of SARS-CoV-2 (COVID-19) RT-PCR?

What is the best annealing temperature for PCR? 

The annealing temperature depends on primer length, GC content and specificity, however, it must be between 50ºC to 68ºC, Ideally, it should be 60ºC to 64ºC. It must be 5 to 7ºC lower than the melting temperature. 

What happens during the annealing step in PCR? 

During the annealing step, primers bind on the template DNA at their complementary regions. 

 

Scroll to Top