PCR primer design guideline: PCR primers are similar as like primer involved in DNA replication in vivo, however, the PCR primers are DNA primers (in vivo primers are RNA primers).

The PCR reaction cannot be completed without the primers, why?

Because the DNA primer used in the amplification facilitates the 3′ end to the Taq DNA polymerase for initiating the amplification.

Once the Primer: DNA junction is recognised by the Taq DNA polymerase, it starts adding dTNPs to the DNA strand and synthesise the new DNA strand.

In this article, we are discussing the role of PCR primer and their properties along with the PCR primer design guidelines as well.

The content of the article is,

  • What is PCR primer?
  • Properties of PCR primers
  • How to design PCR primers
  • Different types of PCR primers
  • Conclusion


Shop Now

What is PCR primer?

“PCR primers are short single-stranded DNA sequences which help in the amplification of DNA during PCR reaction.”

PCR technique is one of the most anticipated technique is genetic science, as it facilitates replication of DNA in vitro, Each and every component of PCR reaction are equally important.

dNTPs, PCR buffer, primer, water, Taq DNA polymerase and template DNA are the major ingredient for PCR reaction. 

PCR reaction completes in three steps (denaturation, annealing and extension). In denaturation, the double-stranded DNA becomes single-stranded (DNA denatured), in the annealing step, the primer binds with its complementary sequence and in elongation step, with the help of dNTPs and Taq DNA polymerase the growing DNA strand expands. 

The figure below,

A comprehensive handbook of long-range PCR

Generally, PCR primers are DNA primers. As we all know that in replication short RNA primers are involved instead of DNA primer while in PCR we are using DNA primer. There are several assumptions that favour the use of DNA primer in PCR :

  1. DNA primers are more temperature stable than RNA primers.
  2. The process of DNA polymerization in PCR is unidirectional so there is no chance of removal of short RNA primer after the polymerization is completed.
  3. Additionally, DNA polymerase I help in removing of short RNA primer in replication in vivo which is not present in PCR. 

The polymerase used in PCR is thermostable and it does not have proofreading activity. For more detail on Taq DNA polymerase, read the article: Function of taq DNA polymerase in PCR

Ultimately, we are interested in studying DNA not RNA that is the reason we want only DNA primer for PCR.

Before we go in depth to PCR Primer design guidelines, we have to understand several terminologies.

The first and foremost is melting temperature and annealing temperature of DNA.

Melting temperature is a temperature at which the half on the DNA (template DNA) is broken opens.  The melting temperature of DNA depends on the GC and AT content of DNA. We know why, right.

The primer binds to the DNA has the same melting temperature as its template. Otherwise, if the temperature is not appropriate then it binds other than its target site.

PCR primer design guidelines

Image credit: www.motekmodern.com/

The annealing temperature is a temperature which required to anneal or bind primer to its complementary strand. The annealing temperature varies from primer to primer.

The primer used in PCR:

Each enzyme required a co-factor and a substrate for completion of the enzymatic reaction, therefore, Taq DNA polymerase required free 3’OH end for starting the polymerization. The primer provides a free 3’ OH end for polymerase and it is work as a substrate for the enzyme to work.

Properties of PCR primers

Annealing temperature:

A temperature at which primer can bind to its complementary sequence is called an annealing temperature.

The annealing temperature is a very important parameter in designing a DNA primer. Annealing temperature should be 5ºC lower than the melting temperature. Melting temperature of the primer is calculated using the formula below,

Tm= 4 (G + C) + 2 (A + T)

An ideal annealing temperature of the primer is ranging between 56ºC to 65ºC. Variation in this range hinders PCR amplification.

If the annealing temperature is too low, the primer can bind to any of the complementary sequences and gives a non-specific result. The primer cannot bind if the annealing temperature is too high.

Length of the primers:

Primers are short sequences, generally, 18 to 23 nucleotide long primer always give the best result in PCR. Shorter primers (>18bp) do not have the affinity to amplify properly in each cycle.

If the primer is too short, annealing temperature becomes lower and it reduces amplification capacity.

Long primers are also not recommended because the annealing temperature of the long primer is too high, it leads to non-specific binding.  However, a long primer is highly specific in long-range PCR.

GC content of primers:

Another important factor in designing the primer is GC content. GC content between 40% to 60% is acceptable. The annealing temperature of the primer between 55ºC  to 65ºC  with 50% GC perform better. 

If GC content is too high, at given annealing temperature primer will mismatch with other sequences. Additionally, GC reach sequences are highly non-specific. The chance of non-specific amplification in GC rich region is very high as compared to the AT-rich region.

It is critical to understand that if 8 to 10 bases of primer will match with other sequences and the annealing temperature is too low, it definitely amplifies the DNA but gives the false result.

Complementation in forward and reverse primers:

While designing primer, keep in mind that both forward and reverse primer do not match with each other or are not complementary with each other. Otherwise, instead of binding with target sequences, both primer will bind with each other and creates a dimer.

See the figure below,

PCR primer design guidelines

Image description: A. the specific binding of primers, B. The primer-dimer formation and amplification of primer dimes and C. The non-specific binding of PCR primers.

More than 4 complementary bases and lower annealing temperature induces dimer formation.  When primers are bind with each other instead of binding with the target sequence, it creates a dimer. Dimers can easily be amplified in PCR because it is shorter sequences of up to 50 to 60 bp.

Repeat bases in primers:

Repeated bases can bind within the primer and makes primer non-active. If some of the dinucleotides or trinucleotide are repeated in primer, it binds within the primer and creates a hairpin loop.

More specifically, if repeat bases are present on the terminal end of 3’ end it will create a serious problem in PCR.

Read further,

  1. What is in situ PCR?
  2. What is gene editing and CRISPR-CAS9?

How to design PCR primers?

During my research works my topics are majorly PCR centred. I want to share my experience on how we can successfully design a primer.

Firstly, Identify your template sequence.

It is very important to identify which gene or DNA fragment we want to amplify. Identify that sequence and obtain it from NCBI.

Now go to the primer 3 software which is open access and freely available primer designing tool and it is widely accepted. However, each primer designing companies have their own primer design software.

You can go to primer 3 from here: http://bioinfo.ut.ee/primer3-0.4.0/

Actually, I think you should try it side by side in another tab. I will Give you one sequence,

This is a beta-globin gene sequence (copy and paste it in a box of primer 3)

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

select your option for forward and reverse primer as indicated by arrow.

Now select the options for forward primer and reverse primer shown as red arrows. Never select the option given in the middle (labelled as black) because we want to run the simple PCR hence we do not need a probe.

In the next step just for understanding read the information given on primer-3 page, read the specification but do not click on any of the boxes because all the information is automatically or by default set by the software.

Click on pic primer button

In the next step as shown in the figure, click on the “Pick primer” button and wait for the result.

The result of primer 3. The red underline line is the length of the PCR product.

The primer 3 output is shown in the figure (above). Analyze first the result window. You can see that the parameters like the length of the primer, GC content, annealing temperature and hairpin formation all are under the standard criteria.

Now take a look at the red line. The primer gives you 231bp fragment so when you run the PCR based on the criteria of this primer, your product should be 231.

The arrows (>>>>>> and <<<<<<<) shows the annealing site of primer to your sequence. Additionally, the software gives you other pairs of possible primers in the bottom as shown in the figure (Below).

The other sets of primer from primer 3 software.

Your primer is ready for the order. In the next step find out the company which gives service in your area. Send them the detail or fill the online form of primer detail. While filling the detail, keep backcrossing your sequence.

If you made a mistake in a single base, you will not get the PCR result or false result.

You will receive the primers in precipitated form with one primer specification paper as shown in the figure. 

The primer specification report. The report is from our standard protocol and just for your understanding.

The specification paper has all the information regarding the primer. It contains the yield at 260nm OD, a sequence of primer, the yield of primer in microgram, the yield of primer in nano mol and other specification as shown in the figure (above).

Our primer is in the form of the solid precipitate. We have to revive it for further use. Recall the PCR procedure, we need an approximately 10pmol primer for our PCR reaction.


We have covered an article on DNA precipitation please read the article for a detailed understanding of DNA precipitation. read the article here: Role of alcohol in DNA extraction


Suppose the given concentration of or primer is 29.1nM. When we add PCR grade water of 291µl to the primer tube, the final concentration of our tube become 100pM/µl.

Do all the procedure in a sterile area now gently try to dissolve the primer in water. This concentration is our stock concentration of PCR primer.   

To achieve 10pmol final concentration for PCR reaction, take 1microliter from the stock primer and add 9µl of water (again PCR grade) to it. Now our primer with 10 pM/µl concentration is read. We can use 1µl from this working.

Different types of PCR primers:

For different reaction, different types of PCR primers are used it depends on which types of polymerase chain reaction we are performing. Depending upon that, different types of primers are enlisted here,

Universal primers:

Primers that can be used in any types of PCR reaction are called universal primers. For example, the primer used in the RAPD is universal primers used in the phylogenetic analysis of plant species.

Less expertise is required to deal with this type of primers because in each reaction the annealing temperature of the primers remains the same.

Furthermore, universal primers are used in the cloning vector DNA amplification.

Target specific primers:

This type of primer is exclusively for the specific sequence or the gene of our interest. The specific primers cannot bind to other location into the gnome. In contrast, universal primers can bind to any location where its complementary sequences are present.

For designing the target-specific primer, we have to follow the above guidelines. It is highly sequence-specific, that is why these primers are more suitable more encountering specific mutations. The success of amplification reaction depends on the annealing temperature.

Degenerate primers:

For amplification and analysis of microbial samples, the degenerative primers are highly recommended. The degenerate primers have the same DNA sequences but are not exactly the same. By using this type of primers, the same gene in two different organisms can be amplified and variation among the species can be determined.

Nested primers:

Nested primers are a special type of primers used into the nested PCR reaction. Two sets of primers are used to amplify the gene in which one set of primer is nested. This nested set of primer binds to the amplified product on the first set of primer.

The nested primer increases the chance of specific amplification by reducing the non-specific bindings.

What is nested PCR?

Inverse primers:

Inverse primers are the primer having the 3′ end outside of the template DNA, therefore, it amplified DNA other than the target DNA.

Inverse primers are used majorly into the site-directed mutagenesis and in vitro mutagenesis. Further, it is widely applicable in plasmid studies.

See the figure below, how inverse primer amplify the DNA.

PCR primer design guidelines

External resources:

PCR Primer Design PCR Primer Design

Conclusion:

For long-term use of primer revive all the primer tubes in TE buffer and make different aliquots of the tubes. Store all tubes in -20°C. 10 pM/µl concentration is sufficient for the 25µl PCR reaction, excess concentration of primer results in dimers and non-specific binding.

I have covered all point on PCR primer design guideline. You can comment below if any point is missing. Conclusively, using our PCR primer design guidelines, you can successfully obtain a result without any hindrance.  

Article written by: Tushar Chauhan

Article reviewed by: Tushar kachhadiya